If you have been reading about reconstitution time and want a single page that covers the useful parts, this is it: definitions, context, how it is studied, and the questions that come up repeatedly.
Last reviewed on 2025-09-24. Where a claim depends on a specific study, the study is described rather than over-claimed.
The physics of lyophilization couples heat transfer, mass transfer, and phase behavior. Sublimation requires a vapor pressure difference between the ice front and the chamber, and the dried layer adds resistance to vapor flow. Amorphous formulations are characterized by a glass transition temperature of the maximally freeze-concentrated solute, often denoted Tg'. Crystalline bulking agents can provide structure, while amorphous excipients stabilize labile components. Open questions remain about spatial heterogeneity, edge effects, and how laboratory cycles scale to production.
Lyophilization is a drying process in which a solvent, usually water, is removed from a frozen material by sublimation under reduced pressure. The material is first solidified, then placed under vacuum so that ice transitions directly to vapor without a bulk liquid phase. This approach suits heat-sensitive substances that would degrade during conventional evaporation. Primary drying removes unbound ice, while secondary drying reduces water that remains adsorbed to the solid matrix. The result is a porous, lightweight solid that can be reconstituted later.
A typical cycle begins with freezing, sometimes including an annealing step to control ice crystal size. Freezing conditions influence the pore network that later allows vapor escape. During primary drying, shelf temperature and chamber pressure are set so heat enters the product while its temperature stays below the collapse or eutectic point. Secondary drying then raises the shelf temperature to desorb bound water and lower residual moisture. Cycle design depends on formulation, fill volume, container type, and equipment capability.
Misconceptions about lyophilization include the idea that dried products are indefinitely stable or that vacuum sealing eliminates all degradation. Chemical reactions can continue in the solid state, and some proteins lose activity even at low moisture. Another misconception is that any freeze-dryer cycle can be scaled by time alone; heat and mass transfer differ with equipment and load. Open questions remain about predicting long-term stability from short accelerated studies, particularly for amorphous formulations. Real-time stability data remain the standard for shelf-life assignment.
After lyophilization, the dried product is often sealed under vacuum or an inert gas to limit moisture and oxygen exposure. Vials, stoppers, and seals must maintain their barrier throughout shelf life. Storage temperature depends on product sensitivity: some cakes tolerate controlled room temperature, while labile biologics require refrigeration. Humidity is a critical variable because dried cakes are hygroscopic and can absorb water when exposed to air. Handling procedures therefore limit open-vial time and use desiccated environments for sampling.
| Property | Value | Notes |
|---|---|---|
| Physical state | Solid, porous cake or powder | Depends on formulation and container |
| Typical storage temperature | 2–25 °C, protected from moisture | Some materials require colder conditions |
| Solubility class | Usually readily soluble after reconstitution | Not an intrinsic chemical property |
| Common analytical method | Karl Fischer titration | Used for residual moisture |
| Common synonyms | Freeze-drying; lyophilisation | Lyophilisation is a spelling variant |
The physics of lyophilization depends on phase boundaries and heat and mass transfer. During primary drying, heat supplied to the product must equal the latent heat of sublimation, while water vapor moves through the drying cake to the condenser. If shelf temperature or pressure is set too high, the ice front can exceed the collapse temperature, causing meltback or pore collapse. If conditions are too cold, drying slows and costs rise. Formulation excipients, vial geometry, and freezing rate alter these limits.
Equipment for lyophilization includes a vacuum chamber, temperature-controlled shelves, a condenser, and a vacuum pump. A refrigeration system cools the shelves and condenser below the product's freezing point. Process monitoring often uses Pirani and capacitance manometers, thermocouples, and resistance sensors. Cycle development balances product quality with time and energy use. Some products are annealed during freezing to improve crystallization of bulking agents. Open questions remain about scaling cycles between laboratory, pilot, and production freeze-dryers.
Lyophilization, also called freeze-drying, removes water from a frozen material by sublimation under reduced pressure. The process begins with freezing, which converts free water into ice and may also produce a glassy phase. Primary drying then lowers chamber pressure so ice sublimes directly to vapor without passing through a liquid stage. Secondary drying raises the temperature modestly to remove bound water. The result is a porous, dry solid that usually reconstitutes quickly. Each stage influences pore structure, residual moisture, and stability.
Quality control also examines cake structure, color, and reconstitution behavior. A collapsed or shrunken cake can indicate a thermal excursion during drying. Analytical methods such as X-ray diffraction, differential scanning calorimetry, and near-infrared spectroscopy can detect crystallinity or moisture distribution. Regulatory expectations focus on validated assays and lot-to-lot consistency. Questions remain about how well accelerated stability tests predict long-term behavior for every formulation. Visual inspection remains common but is subjective without trained reviewers and reference images.
After lyophilization, a product's quality depends on residual moisture, cake appearance, and reconstitution time. Residual moisture is often measured by Karl Fischer titration or thermogravimetric analysis. A low moisture content can slow chemical degradation, but overly dry cakes may be brittle or slow to dissolve. Stability studies track these attributes over months under defined temperature and humidity conditions. Batch records link these measurements to specific process runs and help identify trends before a product fails specification.
== Biological function == G-CSF is produced by endothelium, macrophages, and a number of other immune cells. The natural human glycoprotein exists in two forms, a 174- and 177-amino-acid-long protein of molecular weight 19,600 grams per mole. The more-abundant and more-active 174-amino acid form has been used in the development of pharmaceutical products by recombinant DNA (rDNA) technology.
The Greater Poland uprising of 1918–1919, or Wielkopolska uprising of 1918–1919 (Polish: powstanie wielkopolskie 1918–1919 roku; German: Großpolnischer Aufstand) or Poznań War was a military insurrection of Poles in the Greater Poland region (German: Grand Duchy of Posen or Provinz Posen) against German rule. The uprising had a significant effect on the Treaty of Versailles, which granted a reconstituted Second Polish Republic the area won by the Polish insurrectionists. The region had been part of the Kingdom of Poland and then Polish–Lithuanian Commonwealth before the 1793 Second Partition of Poland when it was annexed by the German Kingdom of Prussia. It had also, following the 1806 Greater Poland uprising, been part of the Duchy of Warsaw (1807–1815), a French client state during the Napoleonic Wars.
=== Anti-thyroid drugs === Treatment with methimazole or propylthiouracil for hyperthyroidism, is commonly associated with an elevation of liver enzymes. To differentiate between hyperthyroidism and drug-related liver injury, it is recommended to check baseline liver enzymes prior to initiation of treatment. If liver injury related to anti-thyroid treatment is significant, switching to the alternative agent can be attempted in most cases. Cases of fulminant liver failure reported with propylthiouracil have led to a regulatory warning, and to guidelines recommending methimazole as the first line anti-thyroid agent.
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
=== Aftermath === An informal memorial was held for Staley on the night of April 20, 2002, at the Seattle Center, which was attended by at least 100 fans and friends, including Alice in Chains bandmates Cantrell, Starr, Inez and Kinney, and Soundgarden frontman Chris Cornell. Staley's body was cremated and a private memorial service was held for him on April 28, 2002 at Kiana Lodge in Poulsbo, Washington. During her appearance on Celebrity Rehab in 2010, Staley's mother said she has kept his ashes in a box. Staley's private memorial was attended by his family and friends, along with his Alice in Chains bandmates, the band's manager Susan Silver and her then-husband Chris Cornell, as well as other music personalities. Chris Cornell, joined by Heart's Ann and Nancy Wilson, sang a rendition of The Rolling Stones' "Wild Horses" at the funeral. They also performed The Lovemongers' song "Sand". Jerry Cantrell dedicated his solo album, Degradation Trip, released two months after Staley's death, to his memory. Cantrell also took in Staley's cat, Sadie, who he and the family took care of until Sadie's death in 2010, at the age of 18. Shortly after Staley's death, his parents Nancy McCallum and Phil Staley started receiving donations from fans all over the world. Nancy and Phil worked with Seattle's Therapeutic Health Services clinic to create the Layne Staley Memorial Fund to help other heroin addicts and their families in the Seattle music community. Alice in Chains remained inactive following Staley's death.
Sources: en.wikipedia.org
== Safe cities == Safe Cities Index 2019, published by the Economist Intelligence Unit, ranked 60 world cities on such criteria as personal safety, digital security, and infrastructure security. Bangkok ranked 47 of 60 (1=most safe; 60=least safe), tied with Ho Chi Minh City. Other ASEAN cities ranked were Singapore, 2; Kuala Lumpur, 35; Manila, 43; Jakarta, 53.
When most of the alar lobule tissue is missing, the nose collapses; the correction is with an ear concha cartilage-graft harvested from the antihelix, a donor site where the cartilage is most rigidly curved, thus is ideal for replacing an alar lobule. Nasal skin defects can be corrected with a medially based bilobed flap, which is emplaced to provide adequate skin coverage for wounds limited to the alar lobule. If the entire lobule is missing, it might be necessary to leave the second-lobe donor-site wound partially open; it will close at 2–4 weeks post-operative; afterwards, the scar can be revised. Nonetheless, the alternative surgical correction is a two-stage, superiorly based, nasolabial flap. If the alar lobule defect also comprehends the lateral wall of the nose, the defect can be closed either with a superiorly based nasolabial-flap or with a forehead flap. If the cheek skin is thin and atrophic, a nasolabial flap is the recommended reconstruction; otherwise, a forehead flap is recommended, because the thickness of forehead skin is a superior match for nasal skin and tissue. Mucosal lining defects of the alar lobule can be resurfaced with a bipedicled mucosal advancement-flap harvested from inside the lateral wall of the nose. Likewise, larger defects of the mucosa do require correction with an anteriorly based septal mucosal flap. III.
The four substrates of this enzyme are salicylic acid, reduced nicotinamide adenine dinucleotide (NADH), oxygen, and a proton, Its products are catechol, oxidised NAD+, water, and carbon dioxide. The enzyme is a flavin-containing monooxygenase that uses molecular oxygen as oxidant and incorporates one of its atoms into the starting material. This enzyme participates in metabolic pathways involving the degradation of naphthalene and anthracene and some of their derivatives. It uses flavin adenine dinucleotide as a cofactor.
After the rule of the Jagiellonian dynasty ended in 1572, Henry of Valois (later King Henry III of France) was the winner of the first "free election" by the Polish nobility, held in 1573. He had to agree to the restrictive pacta conventa obligations and fled Poland in 1574 when news arrived of the vacancy of the French throne, to which he was the heir presumptive. From the start, the royal elections increased foreign influence in the Commonwealth as foreign powers sought to manipulate the Polish nobility to place candidates amicable to their interests. The reign of Stephen Báthory of Hungary followed (r. 1576–1586). He was militarily and domestically assertive and is revered in Polish historical tradition as a rare case of a successful elective king. The establishment of the legal Crown Tribunal in 1578 meant a transfer of many appellate cases from the royal to noble jurisdiction.
Sources: en.wikipedia.org
Freezing only converts liquid to solid. Lyophilization adds vacuum and controlled warming so frozen solvent sublimes, leaving a dry porous solid. The two steps are related but not interchangeable.
Reduced pressure keeps the solvent below its triple point, allowing ice to become vapor without melting. Vacuum also helps remove water vapor from the product chamber. The exact pressure is chosen with the formulation and equipment.
Residual moisture is water that remains in the dried solid after secondary drying. It is often measured by Karl Fischer titration, near-infrared spectroscopy, or thermogravimetry. Acceptable levels depend on the material and its stability profile.
No. Freeze-drying removes water but does not reliably kill microorganisms. Sterile lyophilized products are typically prepared aseptically before freezing or are sterilized by a validated method. Microbial control depends on the entire manufacturing process.